Chain reaction - PDFSEARCH.IO - Document Search Engine

Chain reaction
Results: 4345

#	Item
461	CCCG 2007, Ottawa, Ontario, August 20–22, 2007 Note on the pair-crossing number and the odd-crossing number G´eza T´oth∗ R´enyi Institute, Hungarian Academy of Sciences, Budapest Add to Reading List Source URL: cccg.ca Language: English - Date: 2008-10-28 21:30:22 Amplifiers Hoffmann-La Roche Molecular biology Crossing number Graph Graph theory Mathematics Polymerase chain reaction
462	Figure S1: Summary of the emulsion PCR (emPCR) process Light strand 5‘TAGACGTCATTCAGGTGCCAAACGACTTAACGGGATTAC ATCTGCAGTAAGTCCACGGTTTGCTGAATTGCCCTAATG‘5 dnarts yvaeH 1a) Original template molecules are fragmented and Add to Reading List Source URL: rw.mammoth.psu.edu Language: English - Date: 2008-12-01 13:55:23 Genetics DNA Biotechnology Base pair Nucleic acid sequence Complementarity Pyrosequencing Polymerase chain reaction 454 Life Sciences Biology Molecular biology DNA sequencing
463	www.biotec.or.th www.facebook.com/BIOTECHRD The National Center for Genetic Engineering and Biotechnology (BIOTEC) invites research scientists from developing countries in ASEAN to participate in the Human Resource Devel Add to Reading List Source URL: www.biotec.or.th Language: English - Date: 2015-04-10 02:04:58 Polymerase chain reaction Microbiology Bacteriology Biotechnology Genomics Bacteria Cassava Bioinformatics Rice Biology Molecular biology Laboratory techniques
464	African Journal of Microbiology Research Vol. 5(21), pp, 9 October, 2011 Available online http://www.academicjournals.org/AJMR ISSN ©2011 Academic Journals Full Length Research Paper Add to Reading List Source URL: www.hinter.com.cn Language: English - Date: 2014-07-11 22:27:24 Molecular biology Biotechnology Polymerase chain reaction Laboratory techniques Medical research Aptamer Systematic Evolution of Ligands by Exponential Enrichment Gel electrophoresis Biology Chemistry Biochemistry
465	Analytes offered by the Alabama Department of Public Health - Bureau of Clinical Laboratories Name Division Offered To Add to Reading List Source URL: www.adph.org Language: English - Date: 2015-02-27 14:17:23 Medicine Hematology HIV/AIDS Venipuncture Viral load Sampling Blood culture Polymerase chain reaction Renal function Biology Science Blood tests
466	1.5. New Features and Enhancements: (Fragment from the Oligo 7 Manual) Oligo 7 has been re-written from scratch, to make it fully compatible with everchanging operating systems. Most of the source code is written in Java Add to Reading List Source URL: www.oligo.net Language: English - Date: 2009-08-17 10:50:08 Biochemistry Polymerase chain reaction Laboratory techniques Amplifiers Biotechnology Primer Oligo Nested polymerase chain reaction OLIGO Primer Analysis Software Biology Molecular biology Chemistry
467	Fragile X Reference Materials Characterized by GeT-RM & Other Sources Cell Repository DNA Number Add to Reading List Source URL: wwwn.cdc.gov Language: English - Date: 2013-02-13 14:45:53 Biotechnology Molecular biology Laboratory techniques Celera Corporation Polymerase chain reaction Biology Chemistry Science
468	The Miniprep Basics FREE UPSIZE Macherey-Nagel Lab Essentials Add to Reading List Source URL: scientifix.com.au Language: English - Date: 2015-03-11 19:53:28 Laboratory techniques Polymerase chain reaction Plasmid preparation Plasmid Gel extraction Biology Molecular biology Biochemistry
469	Mycol Progress:1020 DOIs11557ORIGINAL ARTICLE Molecular markers delimit cryptic species Add to Reading List Source URL: www.fabinet.up.ac.za Language: English - Date: 2015-01-13 08:09:49 Chemistry Polymerase chain reaction Ceratocystis Primer Single-nucleotide polymorphism Internal transcribed spacer Multiplex polymerase chain reaction Restriction fragment length polymorphism Microsatellite Biology Molecular biology Biochemistry
470	Gao et al. Genome Biology 2012, 13:R100 http://genomebiology.comR100 RESEARCH Open Access Add to Reading List Source URL: www.genomebiology.com Language: English Molecular biology DNA Genomics Posttranslational modification Methylation DNA methylation DNA methyltransferase Methylated DNA immunoprecipitation Polymerase chain reaction Biology Genetics Epigenetics

UPDATE